Review



algorithms graphpad prism 9 4 158 graphpad software  (Stratedigm Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Stratedigm Inc algorithms graphpad prism 9 4 158 graphpad software
    Algorithms Graphpad Prism 9 4 158 Graphpad Software, supplied by Stratedigm Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+graphpad/pm41632570-215-151-185
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism 9 4 158 graphpad software - by Bioz Stars, 2026-09
    86/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Systematic reconstruction of an effector-gene network reveals determinants of Salmonella cellular and tissue tropism.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LB broth Fisher Scientific Cat#BP9722 LB agar Fisher Scientific Cat#BP9724 Nutrient Broth Becton Dickinson Cat#234000 Paraformaldehyde (4%) Alfa Aesar Cat#47392 PBS Sigma Cat#D8537 RPMI Medium 1640 Thermo Fisher Cat#11875 Saponin MP Biomedicals Cat#102855 Sodium Chloride Fisher Scientific Cat#BP358 Streptomycin sulfate Fisher Scientific Cat#BP910 Sucrose Fisher Science Education Cat#S25590 Triton X-100 Fisher Scientific Cat#BP151 Tryptone Becton Dickinson Cat#211705 Yeast Extract Becton Dickinson Cat#212750 Experimental models: Cell lines Hela ATCC CCL-2 RAW264.7 ATCC TIB-71 HCT116 Mendel Lab N/A T84 Winter Lab N/A H1299 Minna Lab N/A Experimental models: Organisms/strains C57BL/6J mice Jackson Lab 000664 129X1/SvJ mice Jackson Lab 000691 C57BL/6J Nramp1G169 mice (Arpaia et al., 2011) N/A Oligonucleotides See Tables S1–S3 for full list of primers used in this study This Study See Tables S1–S3 Recombinant DNA GFP expression plasmid (Murphy et al., 2002) pBBR1MCS-6y mCherry expression plasmid (Burnaevskiy et al., 2013) pDP151 ori(R6K) mobRP4 Cmr Tetr sacRB (Kingsley et al., 1999) pRDH10 Template plasmid for FRT-flanked KanR cassette (Datsenko and Wanner, 2000) pKD4 Red recombinase expression plasmid (Datsenko and Wanner, 2000) pKD46 Helper plasmid to eliminate the KanR cassette (Datsenko and Wanner, 2000) pCP20 downstream region of STm spvR in pRDH10 This Study pNA101 downstream region of STm pipAB in pRDH10 This Study pNA102 downstream region of STm pipB2 in pRDH10 This Study pNA103 downstream region of STm gtgA in pRDH10 This Study pNA104 downstream region of STm sifB in pRDH10 This Study pNA105 downstream region of STm gtgEsseI in pRDH10 This Study pNA106 downstream region of STm steBsseJ in pRDH10 This Study pNA107 downstream region of STm pipD in pRDH10 This Study pNA108 downstream region of STm sseL in pRDH10 This Study pNA109 downstream region of STm gogBsteE in pRDH10 This Study pNA110 downstream region of STm sopD2 in pRDH10 This Study pNA111 downstream region of STm slrp in pRDH10 This Study pNA112 downstream region of STm steA in pRDH10 This Study pNA113 downstream region of STm steD in pRDH10 This Study pNA114 downstream region of STm sspH2 in pRDH10 This Study pNA115 downstream region of STm sseK2 in pRDH10 This Study pNA116 (Continued on next page) e4 Cell Host & Microbe 29, 1531–1544.e1–e9, October 13, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER downstream region of STm sseK3 in pRDH10 This Study pNA117 downstream region of STm steC in pRDH10 This Study pNA118 downstream region of STm cigR in pRDH10 This Study pNA119 downstream region of STm sseK1 in pRDH10 This Study pNA120 downstream region of STm srfJ in pRDH10 This Study pNA121 downstream region of STm sseFG in pRDH10 This Study pNA122 downstream region of STm sifA in pRDH10 This Study pNA123 downstream region of STm steDsseK2 in pRDH10 This Study pNA124 upstream and downstream regions of STm spvA in pRDH10 This Study pNA125 upstream and downstream regions of STm spvB in pRDH10 This Study pNA126 upstream and downstream regions of STm spvC in pRDH10 This Study pNA127 upstream and downstream regions of STm spvD in pRDH10 This Study pNA128 Fragment of phoN cloned into pGP704 (Spiga et al., 2017) pSW327 Promoter and coding regions of STm spvB in pSW327 This Study pNA129 Promoter and coding regions of STm spvC in pSW327 This Study pNA130 Software and algorithms CellCapTure Stratedigm https://stratedigm.com/cellcapture/ GraphPad Prism 8 GraphPad Software https://www.graphpad.com/ FLowJo BD biosciences https://www.flowjo.com/ Adobe Illustrator Creative Cloud Adobe https://www.adobe.com Adobe Photoshop Creative Cloud Adobe https://www.adobe.com ..

    Software:

    Article Title: Systematic reconstruction of an effector-gene network reveals determinants of Salmonella cellular and tissue tropism.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER LB broth Fisher Scientific Cat#BP9722 LB agar Fisher Scientific Cat#BP9724 Nutrient Broth Becton Dickinson Cat#234000 Paraformaldehyde (4%) Alfa Aesar Cat#47392 PBS Sigma Cat#D8537 RPMI Medium 1640 Thermo Fisher Cat#11875 Saponin MP Biomedicals Cat#102855 Sodium Chloride Fisher Scientific Cat#BP358 Streptomycin sulfate Fisher Scientific Cat#BP910 Sucrose Fisher Science Education Cat#S25590 Triton X-100 Fisher Scientific Cat#BP151 Tryptone Becton Dickinson Cat#211705 Yeast Extract Becton Dickinson Cat#212750 Experimental models: Cell lines Hela ATCC CCL-2 RAW264.7 ATCC TIB-71 HCT116 Mendel Lab N/A T84 Winter Lab N/A H1299 Minna Lab N/A Experimental models: Organisms/strains C57BL/6J mice Jackson Lab 000664 129X1/SvJ mice Jackson Lab 000691 C57BL/6J Nramp1G169 mice (Arpaia et al., 2011) N/A Oligonucleotides See Tables S1–S3 for full list of primers used in this study This Study See Tables S1–S3 Recombinant DNA GFP expression plasmid (Murphy et al., 2002) pBBR1MCS-6y mCherry expression plasmid (Burnaevskiy et al., 2013) pDP151 ori(R6K) mobRP4 Cmr Tetr sacRB (Kingsley et al., 1999) pRDH10 Template plasmid for FRT-flanked KanR cassette (Datsenko and Wanner, 2000) pKD4 Red recombinase expression plasmid (Datsenko and Wanner, 2000) pKD46 Helper plasmid to eliminate the KanR cassette (Datsenko and Wanner, 2000) pCP20 downstream region of STm spvR in pRDH10 This Study pNA101 downstream region of STm pipAB in pRDH10 This Study pNA102 downstream region of STm pipB2 in pRDH10 This Study pNA103 downstream region of STm gtgA in pRDH10 This Study pNA104 downstream region of STm sifB in pRDH10 This Study pNA105 downstream region of STm gtgEsseI in pRDH10 This Study pNA106 downstream region of STm steBsseJ in pRDH10 This Study pNA107 downstream region of STm pipD in pRDH10 This Study pNA108 downstream region of STm sseL in pRDH10 This Study pNA109 downstream region of STm gogBsteE in pRDH10 This Study pNA110 downstream region of STm sopD2 in pRDH10 This Study pNA111 downstream region of STm slrp in pRDH10 This Study pNA112 downstream region of STm steA in pRDH10 This Study pNA113 downstream region of STm steD in pRDH10 This Study pNA114 downstream region of STm sspH2 in pRDH10 This Study pNA115 downstream region of STm sseK2 in pRDH10 This Study pNA116 (Continued on next page) e4 Cell Host & Microbe 29, 1531–1544.e1–e9, October 13, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER downstream region of STm sseK3 in pRDH10 This Study pNA117 downstream region of STm steC in pRDH10 This Study pNA118 downstream region of STm cigR in pRDH10 This Study pNA119 downstream region of STm sseK1 in pRDH10 This Study pNA120 downstream region of STm srfJ in pRDH10 This Study pNA121 downstream region of STm sseFG in pRDH10 This Study pNA122 downstream region of STm sifA in pRDH10 This Study pNA123 downstream region of STm steDsseK2 in pRDH10 This Study pNA124 upstream and downstream regions of STm spvA in pRDH10 This Study pNA125 upstream and downstream regions of STm spvB in pRDH10 This Study pNA126 upstream and downstream regions of STm spvC in pRDH10 This Study pNA127 upstream and downstream regions of STm spvD in pRDH10 This Study pNA128 Fragment of phoN cloned into pGP704 (Spiga et al., 2017) pSW327 Promoter and coding regions of STm spvB in pSW327 This Study pNA129 Promoter and coding regions of STm spvC in pSW327 This Study pNA130 Software and algorithms CellCapTure Stratedigm https://stratedigm.com/cellcapture/ GraphPad Prism 8 GraphPad Software https://www.graphpad.com/ FLowJo BD biosciences https://www.flowjo.com/ Adobe Illustrator Creative Cloud Adobe https://www.adobe.com Adobe Photoshop Creative Cloud Adobe https://www.adobe.com ..

    Article Title: Ongoing evolution of SARS-CoV-2 drives escape from mRNA vaccine-induced humoral immunity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains DH5a Zymo-Competent E. coli Zymo Cat# T3009 Chemicals, peptides, and recombinant proteins Phosphate buffered saline (PBS) Corning Cat# 21-031-CV Dulbecco’s modified eagle medium (DMEM) Corning Cat# 10-013-CV Fetal bovine serum (FBS) VWR Cat# 89510-186 Paraformaldehyde Solution, 4% in PBS, Affymetrix/USBTM Fisher Scientific Cat# AAJ19943K2 Penicillin/streptomycin Corning Cat# 30-002-CI Polyethylenimine 25K MW, linear Polysciences Inc Cat# 23966 Puromycin Sigma Cat# P8833-10MG ATP Sigma Cat# A2383-5G Magnesium chloride BDH Cat# BDH9244-500G Magnesium sulfate BDH Cat# BDH9246-500G Dithiothreitol (DTT) VWR Cat# 97061-338 D-luciferin Gold Bio Cat# LUCK-2G EDTA Sigma Cat# 03690-100ML Triton X-100 Fisher Cat# BP151-500 Polybrene Sigma Cat# H9268-5G qScript XLT 1-Step RT-qPCR ToughMix, Low-ROX Quantabio Cat# 95134-500 Turbo DNase Fisher Cat# AM2239 Recombinant Human ACE-2 His-tag Alexa Fluor 647 Protein R&D Systems Cat# AFR933 Experimental models: Cell lines HEK293T/17 Cells ATCC Cat# CRL-11268 293T/ACE2.MF Obtained from the lab of Dr. Michael Farzan N/A Oligonucleotides Lentivirus LTR qPCR Probe/56-FAM/ AGC+C/i5NitInd/GG + GA/ZEN/GCT CTCTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 50 Primer GGTCTCTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 30 Primer TTTATTGAGGCTTAAGCAGTGGG Integrated DNA Technology N/A Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Plasmid ID 164432 pTwist-SARS-CoV-2 D18 (spike) This study Addgene Plasmid ID 164436 pTwist-SARS-CoV-2 D18 B.1.617.2v1 (spike) This study Addgene Plasmid ID 179905 pTwist-SARS-CoV-2 D18 B.1.351v2 (spike) This study Addgene Plasmid ID 169463 pTwist-SARS-CoV-2 D18 P.1 (spike) This study Addgene Plasmid ID 173476 pTwist-SARS-CoV-2 D18 B.1.1.529 (spike) This study Addgene Plasmid ID 179906 pTwist-SARS-CoV-2 Spike-DC18 A222V (GTG) This study Addgene Plasmid ID 212329 pTwist-SARS-CoV-2 Spike-DC18 D253G (GGC) This study Addgene Plasmid ID 212330 (Continued on next page) Cell Reports Medicine 5, 101850, December 17, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER pTwist-SARS-CoV-2 Spike-DC18 HK.3 This study Addgene Plasmid ID 212572 pTwist-SARS-CoV-2 Spike-DC18 BA.2.86 This study Addgene Plasmid ID 212538 pTwist-SARS-CoV-2 Spike-DC18 JN.1 This study Addgene Plasmid ID 216526 pTwist-SARS-CoV-2 Spike-DC18 KP.2 This study Addgene Plasmid ID 223273 pTwist-SARS-CoV-2 Spike-DC18 KP.3 This study Addgene Plasmid ID 223276 pHDM-Hgpm2 (Gag-Pol) This study Addgene Plasmid ID 164441 pHDM-Tat1b (helper) This study Addgene Plasmid ID 164442 pRC-CMV-Rev1b (helper) This study Addgene Plasmid ID164443 Software and algorithms GraphPad Prism 9.4.158 Graphpad Software www.graphpad.com/scientific- software/prism/; RRID:SCR_002798 Geneious Prime 2023 Geneious http://www.geneious.com/; RRID:SCR_010519 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/ fluent-laboratory-automationworkstation?p=tab–4 R v2023.06.1 + 524 Open source software https://cran.r-project.org/bin/ windows/base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/ en/home/global/forms/quantstudio12k-flex-software-download.html OPEN ACCESS ..

    Article Title: SARS-CoV-2 fusion-peptide-directed antibodies are elicited by natural infection and can mediate broad sarbecovirus neutralization.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER 293T/hDPP4 This study N/A 293T/hANPEP This study N/A Oligonucleotides Lentivirus LTR qPCR Probe/56FAM/AGC+C/i5NitInd/GG + GA/ZEN/ GCTCTCTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 5 ′ Primer GGTCTCTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 3 ′ Primer TTTATTGAGGCTTAAGCAGTGGG Integrated DNA Technology NA Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Plasmid ID 164432 pTwist-SARS-CoV-2 Δ18 (spike) This study Addgene Plasmid ID 164436 pTwist-SARS-CoV-2 Δ18 B.1.617.2v1 (spike) This study Addgene Plasmid ID 179905 pTwist-SARS-CoV-2 Δ18 B.1.351v2 (spike) This study Addgene Plasmid ID 169463 pTwist-SARS-CoV-2 Spike-ΔC18 BA.5 This study Addgene Plasmid ID 212505 pTwist-SARS-CoV Spike-ΔC18 This study Addgene Plasmid ID 169465 pTwist-WIV1 Spike-ΔC18 This study Addgene Plasmid ID 164439 pTwist-NL63 Spike-ΔC17 This study N/A pTwist-229E Spike-ΔC15 This study N/A pTwist-MERS Spike-ΔC15 This study N/A pHDM-Hgpm2 (Gag-Pol) This study Addgene Plasmid ID 164441 pHDM-Tat1b (helper) This study Addgene Plasmid ID 164442 pRC-CMV-Rev1b (helper) This study Addgene Plasmid ID164443 Software and algorithms GraphPad Prism 9.4.158 Graphpad Software www.graphpad.com/scientific-software/prism/; RRID:SCR_002798 Geneious Prime 2023 Geneious http://www.geneious.com/; RRID:SCR_010519 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/fluent-laboratory- automation-workstation?p=tab–4 R v2023.06.1 + 524 Open source software https://cran.r-project.org/bin/windows/base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/en/home/ global/forms/quantstudio-12k-flexsoftware-download.html Cell Reports 45, 116954, February 24, 2026 13 dose 8–9 months after the primary vaccination series, their second booster 4 to 6 months after their first booster and third booster 4 to 7 months after their second booster. ..

    Plasmid Preparation:

    Article Title: Ongoing evolution of SARS-CoV-2 drives escape from mRNA vaccine-induced humoral immunity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains DH5a Zymo-Competent E. coli Zymo Cat# T3009 Chemicals, peptides, and recombinant proteins Phosphate buffered saline (PBS) Corning Cat# 21-031-CV Dulbecco’s modified eagle medium (DMEM) Corning Cat# 10-013-CV Fetal bovine serum (FBS) VWR Cat# 89510-186 Paraformaldehyde Solution, 4% in PBS, Affymetrix/USBTM Fisher Scientific Cat# AAJ19943K2 Penicillin/streptomycin Corning Cat# 30-002-CI Polyethylenimine 25K MW, linear Polysciences Inc Cat# 23966 Puromycin Sigma Cat# P8833-10MG ATP Sigma Cat# A2383-5G Magnesium chloride BDH Cat# BDH9244-500G Magnesium sulfate BDH Cat# BDH9246-500G Dithiothreitol (DTT) VWR Cat# 97061-338 D-luciferin Gold Bio Cat# LUCK-2G EDTA Sigma Cat# 03690-100ML Triton X-100 Fisher Cat# BP151-500 Polybrene Sigma Cat# H9268-5G qScript XLT 1-Step RT-qPCR ToughMix, Low-ROX Quantabio Cat# 95134-500 Turbo DNase Fisher Cat# AM2239 Recombinant Human ACE-2 His-tag Alexa Fluor 647 Protein R&D Systems Cat# AFR933 Experimental models: Cell lines HEK293T/17 Cells ATCC Cat# CRL-11268 293T/ACE2.MF Obtained from the lab of Dr. Michael Farzan N/A Oligonucleotides Lentivirus LTR qPCR Probe/56-FAM/ AGC+C/i5NitInd/GG + GA/ZEN/GCT CTCTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 50 Primer GGTCTCTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 30 Primer TTTATTGAGGCTTAAGCAGTGGG Integrated DNA Technology N/A Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Plasmid ID 164432 pTwist-SARS-CoV-2 D18 (spike) This study Addgene Plasmid ID 164436 pTwist-SARS-CoV-2 D18 B.1.617.2v1 (spike) This study Addgene Plasmid ID 179905 pTwist-SARS-CoV-2 D18 B.1.351v2 (spike) This study Addgene Plasmid ID 169463 pTwist-SARS-CoV-2 D18 P.1 (spike) This study Addgene Plasmid ID 173476 pTwist-SARS-CoV-2 D18 B.1.1.529 (spike) This study Addgene Plasmid ID 179906 pTwist-SARS-CoV-2 Spike-DC18 A222V (GTG) This study Addgene Plasmid ID 212329 pTwist-SARS-CoV-2 Spike-DC18 D253G (GGC) This study Addgene Plasmid ID 212330 (Continued on next page) Cell Reports Medicine 5, 101850, December 17, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER pTwist-SARS-CoV-2 Spike-DC18 HK.3 This study Addgene Plasmid ID 212572 pTwist-SARS-CoV-2 Spike-DC18 BA.2.86 This study Addgene Plasmid ID 212538 pTwist-SARS-CoV-2 Spike-DC18 JN.1 This study Addgene Plasmid ID 216526 pTwist-SARS-CoV-2 Spike-DC18 KP.2 This study Addgene Plasmid ID 223273 pTwist-SARS-CoV-2 Spike-DC18 KP.3 This study Addgene Plasmid ID 223276 pHDM-Hgpm2 (Gag-Pol) This study Addgene Plasmid ID 164441 pHDM-Tat1b (helper) This study Addgene Plasmid ID 164442 pRC-CMV-Rev1b (helper) This study Addgene Plasmid ID164443 Software and algorithms GraphPad Prism 9.4.158 Graphpad Software www.graphpad.com/scientific- software/prism/; RRID:SCR_002798 Geneious Prime 2023 Geneious http://www.geneious.com/; RRID:SCR_010519 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/ fluent-laboratory-automationworkstation?p=tab–4 R v2023.06.1 + 524 Open source software https://cran.r-project.org/bin/ windows/base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/ en/home/global/forms/quantstudio12k-flex-software-download.html OPEN ACCESS ..

    Article Title: SARS-CoV-2 fusion-peptide-directed antibodies are elicited by natural infection and can mediate broad sarbecovirus neutralization.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER 293T/hDPP4 This study N/A 293T/hANPEP This study N/A Oligonucleotides Lentivirus LTR qPCR Probe/56FAM/AGC+C/i5NitInd/GG + GA/ZEN/ GCTCTCTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 5 ′ Primer GGTCTCTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 3 ′ Primer TTTATTGAGGCTTAAGCAGTGGG Integrated DNA Technology NA Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Plasmid ID 164432 pTwist-SARS-CoV-2 Δ18 (spike) This study Addgene Plasmid ID 164436 pTwist-SARS-CoV-2 Δ18 B.1.617.2v1 (spike) This study Addgene Plasmid ID 179905 pTwist-SARS-CoV-2 Δ18 B.1.351v2 (spike) This study Addgene Plasmid ID 169463 pTwist-SARS-CoV-2 Spike-ΔC18 BA.5 This study Addgene Plasmid ID 212505 pTwist-SARS-CoV Spike-ΔC18 This study Addgene Plasmid ID 169465 pTwist-WIV1 Spike-ΔC18 This study Addgene Plasmid ID 164439 pTwist-NL63 Spike-ΔC17 This study N/A pTwist-229E Spike-ΔC15 This study N/A pTwist-MERS Spike-ΔC15 This study N/A pHDM-Hgpm2 (Gag-Pol) This study Addgene Plasmid ID 164441 pHDM-Tat1b (helper) This study Addgene Plasmid ID 164442 pRC-CMV-Rev1b (helper) This study Addgene Plasmid ID164443 Software and algorithms GraphPad Prism 9.4.158 Graphpad Software www.graphpad.com/scientific-software/prism/; RRID:SCR_002798 Geneious Prime 2023 Geneious http://www.geneious.com/; RRID:SCR_010519 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/fluent-laboratory- automation-workstation?p=tab–4 R v2023.06.1 + 524 Open source software https://cran.r-project.org/bin/windows/base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/en/home/ global/forms/quantstudio-12k-flexsoftware-download.html Cell Reports 45, 116954, February 24, 2026 13 dose 8–9 months after the primary vaccination series, their second booster 4 to 6 months after their first booster and third booster 4 to 7 months after their second booster. ..

    Control:

    Article Title: Ongoing evolution of SARS-CoV-2 drives escape from mRNA vaccine-induced humoral immunity.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains DH5a Zymo-Competent E. coli Zymo Cat# T3009 Chemicals, peptides, and recombinant proteins Phosphate buffered saline (PBS) Corning Cat# 21-031-CV Dulbecco’s modified eagle medium (DMEM) Corning Cat# 10-013-CV Fetal bovine serum (FBS) VWR Cat# 89510-186 Paraformaldehyde Solution, 4% in PBS, Affymetrix/USBTM Fisher Scientific Cat# AAJ19943K2 Penicillin/streptomycin Corning Cat# 30-002-CI Polyethylenimine 25K MW, linear Polysciences Inc Cat# 23966 Puromycin Sigma Cat# P8833-10MG ATP Sigma Cat# A2383-5G Magnesium chloride BDH Cat# BDH9244-500G Magnesium sulfate BDH Cat# BDH9246-500G Dithiothreitol (DTT) VWR Cat# 97061-338 D-luciferin Gold Bio Cat# LUCK-2G EDTA Sigma Cat# 03690-100ML Triton X-100 Fisher Cat# BP151-500 Polybrene Sigma Cat# H9268-5G qScript XLT 1-Step RT-qPCR ToughMix, Low-ROX Quantabio Cat# 95134-500 Turbo DNase Fisher Cat# AM2239 Recombinant Human ACE-2 His-tag Alexa Fluor 647 Protein R&D Systems Cat# AFR933 Experimental models: Cell lines HEK293T/17 Cells ATCC Cat# CRL-11268 293T/ACE2.MF Obtained from the lab of Dr. Michael Farzan N/A Oligonucleotides Lentivirus LTR qPCR Probe/56-FAM/ AGC+C/i5NitInd/GG + GA/ZEN/GCT CTCTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 50 Primer GGTCTCTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 30 Primer TTTATTGAGGCTTAAGCAGTGGG Integrated DNA Technology N/A Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Plasmid ID 164432 pTwist-SARS-CoV-2 D18 (spike) This study Addgene Plasmid ID 164436 pTwist-SARS-CoV-2 D18 B.1.617.2v1 (spike) This study Addgene Plasmid ID 179905 pTwist-SARS-CoV-2 D18 B.1.351v2 (spike) This study Addgene Plasmid ID 169463 pTwist-SARS-CoV-2 D18 P.1 (spike) This study Addgene Plasmid ID 173476 pTwist-SARS-CoV-2 D18 B.1.1.529 (spike) This study Addgene Plasmid ID 179906 pTwist-SARS-CoV-2 Spike-DC18 A222V (GTG) This study Addgene Plasmid ID 212329 pTwist-SARS-CoV-2 Spike-DC18 D253G (GGC) This study Addgene Plasmid ID 212330 (Continued on next page) Cell Reports Medicine 5, 101850, December 17, 2024 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER pTwist-SARS-CoV-2 Spike-DC18 HK.3 This study Addgene Plasmid ID 212572 pTwist-SARS-CoV-2 Spike-DC18 BA.2.86 This study Addgene Plasmid ID 212538 pTwist-SARS-CoV-2 Spike-DC18 JN.1 This study Addgene Plasmid ID 216526 pTwist-SARS-CoV-2 Spike-DC18 KP.2 This study Addgene Plasmid ID 223273 pTwist-SARS-CoV-2 Spike-DC18 KP.3 This study Addgene Plasmid ID 223276 pHDM-Hgpm2 (Gag-Pol) This study Addgene Plasmid ID 164441 pHDM-Tat1b (helper) This study Addgene Plasmid ID 164442 pRC-CMV-Rev1b (helper) This study Addgene Plasmid ID164443 Software and algorithms GraphPad Prism 9.4.158 Graphpad Software www.graphpad.com/scientific- software/prism/; RRID:SCR_002798 Geneious Prime 2023 Geneious http://www.geneious.com/; RRID:SCR_010519 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/ fluent-laboratory-automationworkstation?p=tab–4 R v2023.06.1 + 524 Open source software https://cran.r-project.org/bin/ windows/base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/ en/home/global/forms/quantstudio12k-flex-software-download.html OPEN ACCESS ..

    Article Title: SARS-CoV-2 fusion-peptide-directed antibodies are elicited by natural infection and can mediate broad sarbecovirus neutralization.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER 293T/hDPP4 This study N/A 293T/hANPEP This study N/A Oligonucleotides Lentivirus LTR qPCR Probe/56FAM/AGC+C/i5NitInd/GG + GA/ZEN/ GCTCTCTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 5 ′ Primer GGTCTCTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 3 ′ Primer TTTATTGAGGCTTAAGCAGTGGG Integrated DNA Technology NA Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Plasmid ID 164432 pTwist-SARS-CoV-2 Δ18 (spike) This study Addgene Plasmid ID 164436 pTwist-SARS-CoV-2 Δ18 B.1.617.2v1 (spike) This study Addgene Plasmid ID 179905 pTwist-SARS-CoV-2 Δ18 B.1.351v2 (spike) This study Addgene Plasmid ID 169463 pTwist-SARS-CoV-2 Spike-ΔC18 BA.5 This study Addgene Plasmid ID 212505 pTwist-SARS-CoV Spike-ΔC18 This study Addgene Plasmid ID 169465 pTwist-WIV1 Spike-ΔC18 This study Addgene Plasmid ID 164439 pTwist-NL63 Spike-ΔC17 This study N/A pTwist-229E Spike-ΔC15 This study N/A pTwist-MERS Spike-ΔC15 This study N/A pHDM-Hgpm2 (Gag-Pol) This study Addgene Plasmid ID 164441 pHDM-Tat1b (helper) This study Addgene Plasmid ID 164442 pRC-CMV-Rev1b (helper) This study Addgene Plasmid ID164443 Software and algorithms GraphPad Prism 9.4.158 Graphpad Software www.graphpad.com/scientific-software/prism/; RRID:SCR_002798 Geneious Prime 2023 Geneious http://www.geneious.com/; RRID:SCR_010519 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/fluent-laboratory- automation-workstation?p=tab–4 R v2023.06.1 + 524 Open source software https://cran.r-project.org/bin/windows/base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/en/home/ global/forms/quantstudio-12k-flexsoftware-download.html Cell Reports 45, 116954, February 24, 2026 13 dose 8–9 months after the primary vaccination series, their second booster 4 to 6 months after their first booster and third booster 4 to 7 months after their second booster. ..

    Real-time Polymerase Chain Reaction:

    Article Title: SARS-CoV-2 fusion-peptide-directed antibodies are elicited by natural infection and can mediate broad sarbecovirus neutralization.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER 293T/hDPP4 This study N/A 293T/hANPEP This study N/A Oligonucleotides Lentivirus LTR qPCR Probe/56FAM/AGC+C/i5NitInd/GG + GA/ZEN/ GCTCTCTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 5 ′ Primer GGTCTCTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 3 ′ Primer TTTATTGAGGCTTAAGCAGTGGG Integrated DNA Technology NA Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Plasmid ID 164432 pTwist-SARS-CoV-2 Δ18 (spike) This study Addgene Plasmid ID 164436 pTwist-SARS-CoV-2 Δ18 B.1.617.2v1 (spike) This study Addgene Plasmid ID 179905 pTwist-SARS-CoV-2 Δ18 B.1.351v2 (spike) This study Addgene Plasmid ID 169463 pTwist-SARS-CoV-2 Spike-ΔC18 BA.5 This study Addgene Plasmid ID 212505 pTwist-SARS-CoV Spike-ΔC18 This study Addgene Plasmid ID 169465 pTwist-WIV1 Spike-ΔC18 This study Addgene Plasmid ID 164439 pTwist-NL63 Spike-ΔC17 This study N/A pTwist-229E Spike-ΔC15 This study N/A pTwist-MERS Spike-ΔC15 This study N/A pHDM-Hgpm2 (Gag-Pol) This study Addgene Plasmid ID 164441 pHDM-Tat1b (helper) This study Addgene Plasmid ID 164442 pRC-CMV-Rev1b (helper) This study Addgene Plasmid ID164443 Software and algorithms GraphPad Prism 9.4.158 Graphpad Software www.graphpad.com/scientific-software/prism/; RRID:SCR_002798 Geneious Prime 2023 Geneious http://www.geneious.com/; RRID:SCR_010519 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/fluent-laboratory- automation-workstation?p=tab–4 R v2023.06.1 + 524 Open source software https://cran.r-project.org/bin/windows/base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/en/home/ global/forms/quantstudio-12k-flexsoftware-download.html Cell Reports 45, 116954, February 24, 2026 13 dose 8–9 months after the primary vaccination series, their second booster 4 to 6 months after their first booster and third booster 4 to 7 months after their second booster. ..

    Recombinant:

    Article Title: SARS-CoV-2 fusion-peptide-directed antibodies are elicited by natural infection and can mediate broad sarbecovirus neutralization.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER 293T/hDPP4 This study N/A 293T/hANPEP This study N/A Oligonucleotides Lentivirus LTR qPCR Probe/56FAM/AGC+C/i5NitInd/GG + GA/ZEN/ GCTCTCTGGC/3IABkFQ/ Integrated DNA Technology N/A Lentivirus LTR qPCR 5 ′ Primer GGTCTCTCTIGITAGACCAG Integrated DNA Technology N/A Lentivirus LTR qPCR 3 ′ Primer TTTATTGAGGCTTAAGCAGTGGG Integrated DNA Technology NA Recombinant DNA pHAGE-CMV-Luc2-IRES-ZsGreen-W (backbone) This study Addgene Plasmid ID 164432 pTwist-SARS-CoV-2 Δ18 (spike) This study Addgene Plasmid ID 164436 pTwist-SARS-CoV-2 Δ18 B.1.617.2v1 (spike) This study Addgene Plasmid ID 179905 pTwist-SARS-CoV-2 Δ18 B.1.351v2 (spike) This study Addgene Plasmid ID 169463 pTwist-SARS-CoV-2 Spike-ΔC18 BA.5 This study Addgene Plasmid ID 212505 pTwist-SARS-CoV Spike-ΔC18 This study Addgene Plasmid ID 169465 pTwist-WIV1 Spike-ΔC18 This study Addgene Plasmid ID 164439 pTwist-NL63 Spike-ΔC17 This study N/A pTwist-229E Spike-ΔC15 This study N/A pTwist-MERS Spike-ΔC15 This study N/A pHDM-Hgpm2 (Gag-Pol) This study Addgene Plasmid ID 164441 pHDM-Tat1b (helper) This study Addgene Plasmid ID 164442 pRC-CMV-Rev1b (helper) This study Addgene Plasmid ID164443 Software and algorithms GraphPad Prism 9.4.158 Graphpad Software www.graphpad.com/scientific-software/prism/; RRID:SCR_002798 Geneious Prime 2023 Geneious http://www.geneious.com/; RRID:SCR_010519 FlowJo 10 FlowJo https://www.flowjo.com; RRID:SCR_008520 Fluent Control Tecan https://lifesciences.tecan.com/fluent-laboratory- automation-workstation?p=tab–4 R v2023.06.1 + 524 Open source software https://cran.r-project.org/bin/windows/base/; RRID:SCR_001905 CellCapTure Stratedigm https://stratedigm.com/cellcapture/ QuantStudio 12K Software v1.3 Applied Biosciences https://www.thermofisher.com/us/en/home/ global/forms/quantstudio-12k-flexsoftware-download.html Cell Reports 45, 116954, February 24, 2026 13 dose 8–9 months after the primary vaccination series, their second booster 4 to 6 months after their first booster and third booster 4 to 7 months after their second booster. ..



    Similar Products

    algorithms graphpad prism  (Tree Star Inc)
    86
    Tree Star Inc algorithms graphpad prism
    Algorithms Graphpad Prism, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+graphpad/flowjo10/pm42268710-553-201-212
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms prism 8 0 graphpad  (Deepmind Technologies Ltd)
    86
    Deepmind Technologies Ltd algorithms prism 8 0 graphpad
    Algorithms Prism 8 0 Graphpad, supplied by Deepmind Technologies Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+graphpad/1+10+3+algorithms+graphpad+graphpad+prism+software/pm42228568-188-165-178
    Average 86 stars, based on 1 article reviews
    algorithms prism 8 0 graphpad - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms graphpad prism version 9 5 1 graphpad  (Tree Star Inc)
    86
    Tree Star Inc algorithms graphpad prism version 9 5 1 graphpad
    Algorithms Graphpad Prism Version 9 5 1 Graphpad, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+graphpad/flowjo10/pm42166330-192-5-19
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism version 9 5 1 graphpad - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms graphpad prism dotmatics  (Dotmatics Limited)
    86
    Dotmatics Limited algorithms graphpad prism dotmatics
    Algorithms Graphpad Prism Dotmatics, supplied by Dotmatics Limited, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+graphpad/graphpad+prism/pm41903141-212-194-197
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism dotmatics - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms graphpad prism 10 4 1 graphpad software  (Deepmind Technologies Ltd)
    86
    Deepmind Technologies Ltd algorithms graphpad prism 10 4 1 graphpad software
    Algorithms Graphpad Prism 10 4 1 Graphpad Software, supplied by Deepmind Technologies Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+graphpad/1+10+3+algorithms+graphpad+graphpad+prism+software/pm41903133-211-97-117
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism 10 4 1 graphpad software - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms graphpad prism 10 3 1 graphpad software  (Deepmind Technologies Ltd)
    86
    Deepmind Technologies Ltd algorithms graphpad prism 10 3 1 graphpad software
    Algorithms Graphpad Prism 10 3 1 Graphpad Software, supplied by Deepmind Technologies Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+graphpad/1+10+3+algorithms+graphpad+graphpad+prism+software/pm41824449-733-235-256
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism 10 3 1 graphpad software - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms prism graphpad software  (Biognosys)
    86
    Biognosys algorithms prism graphpad software
    Algorithms Prism Graphpad Software, supplied by Biognosys, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+graphpad/algorithms+graphpad+prism+software/pm41747732-295-59-89
    Average 86 stars, based on 1 article reviews
    algorithms prism graphpad software - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms flowjo software 10 10 tree star rrid scr 008520 graphpad prism 10 graphpad software  (Tree Star Inc)
    86
    Tree Star Inc algorithms flowjo software 10 10 tree star rrid scr 008520 graphpad prism 10 graphpad software
    Algorithms Flowjo Software 10 10 Tree Star Rrid Scr 008520 Graphpad Prism 10 Graphpad Software, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+graphpad/flowjo10/pm41734064-296-7-11
    Average 86 stars, based on 1 article reviews
    algorithms flowjo software 10 10 tree star rrid scr 008520 graphpad prism 10 graphpad software - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms graphpad prism 9 4 158 graphpad software  (Stratedigm Inc)
    86
    Stratedigm Inc algorithms graphpad prism 9 4 158 graphpad software
    Algorithms Graphpad Prism 9 4 158 Graphpad Software, supplied by Stratedigm Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+graphpad/pm41632570-215-151-185
    Average 86 stars, based on 1 article reviews
    algorithms graphpad prism 9 4 158 graphpad software - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    algorithms nis element nikon n a prism graphpad n a matlab mathworks n a e1 cell reports 6  (Addgene inc)
    94
    Addgene inc algorithms nis element nikon n a prism graphpad n a matlab mathworks n a e1 cell reports 6
    Algorithms Nis Element Nikon N A Prism Graphpad N A Matlab Mathworks N A E1 Cell Reports 6, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+graphpad/5W9Q+(MBD1)+(Plasmid+%23101265)/pm41592533-317-89-86
    Average 94 stars, based on 1 article reviews
    algorithms nis element nikon n a prism graphpad n a matlab mathworks n a e1 cell reports 6 - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier

    Image Search Results